Review



donkey serum jackson immunoresearch  (Jackson Immuno)


Bioz Verified Symbol Jackson Immuno is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Jackson Immuno donkey serum jackson immunoresearch
    Donkey Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 5004 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pm41932324-250-113-115
    Average 96 stars, based on 5004 article reviews
    donkey serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    CyQUANT Assay:

    Article Title: TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS.
    Article Snippet: Article TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS Highlights • UPF1 targets in human motor neurons have GC-rich, long, structured 3′ UTRs • TDP-43 loss reduces UPF1 phosphorylation and impairs mRNA surveillance • UPF1 and TDP-43 physically interact and co-aggregate in pathological inclusions • UPF1 and TDP-43 co-regulate APA, leading to extended 3′ UTRs in neuronal mRNAs Authors Francesco Alessandrini, Matthew Wright, Tatsuaki Kurosaki, ..., Christopher J. Donnelly, Lynne E. Maquat, Evangelos Kiskinis Correspondence evangelos.kiskinis@northwestern.edu In brief Alessandrini et al. map UPF1-mediated RNA decay in human motor neurons and show that TDP-43 dysfunction impairs RNA surveillance.. UPF1 and TDP-43 proteins interact and co-aggregate in pathological inclusions; they also co- regulate alternative polyadenylation of specific transcripts extending 3′ UTRs, revealing a shared pathway underlying ALS-related RNA dysregulation.. Alessandrini et al., 2026, Neuron 114, 1–21 February 18, 2026 © 2025 The Author(s).

    LDH Cytotoxicity Assay:

    Article Title: TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS.
    Article Snippet: Article TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS Highlights • UPF1 targets in human motor neurons have GC-rich, long, structured 3′ UTRs • TDP-43 loss reduces UPF1 phosphorylation and impairs mRNA surveillance • UPF1 and TDP-43 physically interact and co-aggregate in pathological inclusions • UPF1 and TDP-43 co-regulate APA, leading to extended 3′ UTRs in neuronal mRNAs Authors Francesco Alessandrini, Matthew Wright, Tatsuaki Kurosaki, ..., Christopher J. Donnelly, Lynne E. Maquat, Evangelos Kiskinis Correspondence evangelos.kiskinis@northwestern.edu In brief Alessandrini et al. map UPF1-mediated RNA decay in human motor neurons and show that TDP-43 dysfunction impairs RNA surveillance.. UPF1 and TDP-43 proteins interact and co-aggregate in pathological inclusions; they also co- regulate alternative polyadenylation of specific transcripts extending 3′ UTRs, revealing a shared pathway underlying ALS-related RNA dysregulation.. Alessandrini et al., 2026, Neuron 114, 1–21 February 18, 2026 © 2025 The Author(s).

    SYBR Green Assay:

    Article Title: TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS.
    Article Snippet: Article TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS Highlights • UPF1 targets in human motor neurons have GC-rich, long, structured 3′ UTRs • TDP-43 loss reduces UPF1 phosphorylation and impairs mRNA surveillance • UPF1 and TDP-43 physically interact and co-aggregate in pathological inclusions • UPF1 and TDP-43 co-regulate APA, leading to extended 3′ UTRs in neuronal mRNAs Authors Francesco Alessandrini, Matthew Wright, Tatsuaki Kurosaki, ..., Christopher J. Donnelly, Lynne E. Maquat, Evangelos Kiskinis Correspondence evangelos.kiskinis@northwestern.edu In brief Alessandrini et al. map UPF1-mediated RNA decay in human motor neurons and show that TDP-43 dysfunction impairs RNA surveillance.. UPF1 and TDP-43 proteins interact and co-aggregate in pathological inclusions; they also co- regulate alternative polyadenylation of specific transcripts extending 3′ UTRs, revealing a shared pathway underlying ALS-related RNA dysregulation.. Alessandrini et al., 2026, Neuron 114, 1–21 February 18, 2026 © 2025 The Author(s).

    Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice.
    Article Snippet: In brief Garg et al. use bidirectional reprogramming between embryonic stem (ES) cells and extra-embryonic endoderm (XEN) stem cells to probe transcriptional and epigenetic factors that direct lineage specification in vivo and facilitate or prevent lineage interconversions.. A strong endoderm transcriptional program and distinct epigenetic state accompany extra-embryonic endoderm specification and prevent lineage conversion.

    Bicinchoninic Acid Protein Assay:

    Article Title: TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS.
    Article Snippet: Article TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS Highlights • UPF1 targets in human motor neurons have GC-rich, long, structured 3′ UTRs • TDP-43 loss reduces UPF1 phosphorylation and impairs mRNA surveillance • UPF1 and TDP-43 physically interact and co-aggregate in pathological inclusions • UPF1 and TDP-43 co-regulate APA, leading to extended 3′ UTRs in neuronal mRNAs Authors Francesco Alessandrini, Matthew Wright, Tatsuaki Kurosaki, ..., Christopher J. Donnelly, Lynne E. Maquat, Evangelos Kiskinis Correspondence evangelos.kiskinis@northwestern.edu In brief Alessandrini et al. map UPF1-mediated RNA decay in human motor neurons and show that TDP-43 dysfunction impairs RNA surveillance.. UPF1 and TDP-43 proteins interact and co-aggregate in pathological inclusions; they also co- regulate alternative polyadenylation of specific transcripts extending 3′ UTRs, revealing a shared pathway underlying ALS-related RNA dysregulation.. Alessandrini et al., 2026, Neuron 114, 1–21 February 18, 2026 © 2025 The Author(s).

    Recombinant:

    Article Title: TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS.
    Article Snippet: Article TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS Highlights • UPF1 targets in human motor neurons have GC-rich, long, structured 3′ UTRs • TDP-43 loss reduces UPF1 phosphorylation and impairs mRNA surveillance • UPF1 and TDP-43 physically interact and co-aggregate in pathological inclusions • UPF1 and TDP-43 co-regulate APA, leading to extended 3′ UTRs in neuronal mRNAs Authors Francesco Alessandrini, Matthew Wright, Tatsuaki Kurosaki, ..., Christopher J. Donnelly, Lynne E. Maquat, Evangelos Kiskinis Correspondence evangelos.kiskinis@northwestern.edu In brief Alessandrini et al. map UPF1-mediated RNA decay in human motor neurons and show that TDP-43 dysfunction impairs RNA surveillance.. UPF1 and TDP-43 proteins interact and co-aggregate in pathological inclusions; they also co- regulate alternative polyadenylation of specific transcripts extending 3′ UTRs, revealing a shared pathway underlying ALS-related RNA dysregulation.. Alessandrini et al., 2026, Neuron 114, 1–21 February 18, 2026 © 2025 The Author(s).

    Article Title: Pain hypersensitivity is dependent on autophagy protein Beclin 1 in males but not females.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies b-actin (mouse) Sigma-Aldrich Cat# A2228; RRID: AB_476697 b-actin (rabbit) Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Beclin (mouse) Abcam Cat# ab207612; RRID: AB_2692326 GluN2B (mouse) BD Transductions Cat# 610416; RRID: AB_397796 LC3B (Mouse) Cell Signaling Technology Cat# 83506; RRID: AB_2800018 SQSTM1/p62 (mouse) Abcam Cat# ab56416; RRID: AB_945626 IRDye 680RD Donkey anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68072; RRID: AB_10953628 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68070; RRID: AB_10956588 IRDye 800CW Donkey anti-Rabbit IgG Secondary Antibody LI-COR Cat# 926-32213; RRID: AB_621848 Iba1 (Rabbit) Wako Cat# 019-19741; RRID: AB_839504 GFAP (Mouse) Sigma-Aldrich Cat# G3893; RRID: AB_477010 CyTM2 AffiniPureTM Donkey Anti-Rabbit IgG Secondary Antibody Jackson ImmunoResearch Cat# 711-225-152; RRID: AB_2340612 CyTM3 AffiniPureTM Donkey Anti-Mouse IgG Secondary Antibody Jackson ImmunoResearch Cat# 715-165-150; RRID: AB_2340813 Chemicals, peptides, and recombinant proteins Tat-beclin 1 (YGRKKRRQRRRGGTN VFNATFEIWHDGEFGT) Genscript N/A Tat-scrambled (YGRKKRRQRRRGGVG NDFFINHETTGFATEW) Genscript N/A Recombinant human BDNF protein Alomone Cat# B-250 Y1036 Calbiochem Cat# 480870 BLUelf Prestained Protein Ladder Froggabio Cat# PM007-0500 Intercept (TBS) Blocking Buffer LI-COR Cat# 927-60001 ( )-Bicuculline methochloride Tocris Cat# 0131 Tetrodotoxin citrate Alomone Labs Cat# T-550 Glycine Sigma-Aldrich Cat# G5417 Strychnine Sigma-Aldrich Cat# S0532 BAPTA, Tetrapotassium Salt, cell impermeant Invitrogen Cat# B1204 Formalin Fisher chemical Cat# SF98-4 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Freund’s Adjuvant, Complete Sigma-Aldrich Cat# F5881 Protease inhibitor cocktail Set I Millipore Cat# 539131 Phosphatase inhibitor cocktail set II Millipore Cat# 524625 Poly-D-lysine hydrobromide Sigma-Aldrich Cat# P6407-5MG Neurobasal Medium Gibco Cat# 21103-049 Hanks Balanced Salt Solution Gibco Cat# 24020-117 B-27 Supplement Gibco Cat# 17504-044 L-Glutamine Gibco Cat# 25030-081 Fetal Bovine Serum Gibco Cat# 26140-079 (Continued on next page) 12 Cell Reports 43, 114293, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ADVANCED DNA Fast Extract Kit Wisent Cat# 801-200-DR ADVANCED 2X HS-Red Taq PCR Mastermix Wisent Cat# 801-200-MM Pierce BCA Protein Assay Reagent A Thermo Scientific Cat# PI23223 Pierce BCA Protein Assay Reagent B Thermo Scientific Cat# PI23224 Experimental models: Organisms/strains C57BL/6J mice Jackson Laboratory C57BL/6J Wistar rats Charles River N/A Becn1loxP Yeganeh et al.11 C57BL/6NTac-Becn1tm1a(KOMP)Wtsi/ Cnrm X B6; SJL-Tg(ACTFLPe)9205Dym/J CMV-cre mice Jackson Laboratory B6.C-Tg(CMV-cre)1Cgn/J Becn1F121A Rocchi et al.24 B6.129(Cg)-Becn1tm2.1Blev/J Oligonucleotides Becn1 knockout genotyping primer set Integrated DNA Technologies Table S1 Becn1F121A genotyping primer set Integrated DNA Technologies Table S1 Software and algorithms Image Studio 5.2 LI-COR https://www.licor.com/bio/image-studio/ Prism 9 GraphPad Software https://www.graphpad.com/ Clampex 10.7 and Clampfit 10.7 Molecular Devices https://support.moleculardevices.com/s/ article/Axon-pCLAMP-10Electrophysiology-Data-AcquisitionAnalysis-Software-Download-Page Mini Analysis Program 6.0 Synaptosoft RRID:SCR_002184 CaseViewer 2.4 3DHISTECH https://www.3dhistech.com/solutions/ caseviewer/ BioRender BioRender https://www.biorender.com/

    Article Title: Characterization of cell-fate decision landscapes by estimating transcription factor dynamics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Sheep anti NEUROG3 R&D systems Cat#AF3444; RRID:AB_2149527 Chicken anti GFP Abcam Cat#ab13970; RRID:AB_300798 Alexa Fluor 647 Mouse anti-Nkx6-1 BD Biosciences Cat#563338; RRID: AB_2738144 Donkey anti Sheep-Alexa Fluor 647 Jackson ImmunoResearch Cat#713-605-147; RRID:AB_2340751 Donkey anti Chicken-DyLight 488 Jackson ImmunoResearch Cat#703-486-155; RRID:AB_2736851 Chemicals, peptides, and recombinant proteins TrypLE Select Thermo Fischer Scientific Cat#12563011 mTeSR1 STEMCELL Technologies Cat#85850 Matrigel Growth Factors Reduced Corning Cat#356231 Matrigel hESC-qualified Corning Cat#354277 DMEM/F12 Thermo Fischer Scientific Cat#21331020 PBS (without Ca2+ and Mg2+) Thermo Fischer Scientific Cat#14190094 MCDB 131 Thermo Fischer Scientific Cat#10372019 GlutaMAX Thermo Fischer Scientific Cat#35050038 Penicillin-Streptomycin Thermo Fischer Scientific Cat#15140130 Sodium bicarbonate Thermo Fischer Scientific Cat#25080060 D-Glucose Sigma Cat#G7021 Bovine Serum Albumin Fraction V, fatty acid free, Roche Sigma Cat#10775835001 ITS-X Thermo Fischer Scientific Cat#51500056 Y-27632 STEMCELL Technologies Cat#72304 Activin A STEMCELL Technologies Cat#78001.1 CHIR99021 Axon Medchem Cat#1386 L-Ascorbic Acid Sigma Cat#A4544 FGF7 Peprotech Cat#100-19 SANT-1 Sigma Cat#S4572 LDN193189 Stemgent Cat#04-0074 TBP (PKC act V) Millipore EMD Cat#565740 Retinoic Acid Sigma Cat#R2625 ZnSO4 Sigma Cat#Z0251 ALK5i II ENZO Cat#ALX 270 445 heparine Sigma Cat#H3149 T3 Sigma Cat#T6397 Donkey serum Jackson Immunoresearch Cat017-000-121 Paraformaldehyde 16% EUROMEDEX Cat#15710 Triton X-100 Sigma Cat#T8787 Critical commercial assays 384-well plates for scRNA SortSeq, containing ERCC spike-ins, reverse transcription primers and dNTPs, provided by Single Cell Discoveries Single Cell Discoveries N/A Human Stem Cell Nucleofector Kit 2 LONZA Cat#VPH-5022 12-well plates CellBind Corning Cat#3336 (Continued on next page) e1 Cell Reports Methods 3, 100512, July 24, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 50 mm nylon mesh NITEX Dutscher Cat#074010 50 mM sterile Filcon BD Biosciences Cat#340602 Deposited data Mouse embryonic pancreatic endocrine differentiation scRNAseq data at E15.5 Bastidas-Ponce et al., 201819 GSE132188 Time course of human in-vitro differentiation toward b-like cells scRNAseq data at stage 5 Veres et al., 201920 GSE114412 Raw scRNAseq data at PEP stage from NKX6-1-GFP/NEUROG3-HA-mCherry hiPS cell line This paper GSE202092 Experimental models: Cell lines Human: NKX6-1-GFP/NEUROG3-HA-mCherry clone#10 hiPS cells This paper N/A Human: NKX6-1-GFP (1a-21) hiPS cells Provided by C. Honoré (NovoNordisk) IMI/EU sponsored StemBANCC Gupta et al., 201875 Oligonucleotides sgRNA Fwd CACCGTGAAAGGAC CTGTCTGTCGC This paper N/A sgRNA Rev AAACGCGACAGACA GGTCCTTTCAC This paper N/A PCRwt_F CTTTGTCCGGAATCCAGCTG This paper N/A PCRwt_R CCTTACCCTTAGCACCCACA This paper N/A PCRki_F AAAGAGGGATCCTCTGACCCA This paper N/A PCRki_R ACATGAACTGAGGGGACAGG This paper N/A Recombinant DNA pX458 plasmid Addgene 48138 pBS-hNEUROG3-3HA-2A-3NLS-mCherry-pA This paper N/A Software and algorithms Dyngen v1.0.5 Cannoodt et al., 202128 https://github.com/dynverse/dyngen Scanpy v1.8.2 Wolf et al., 201876 https://scanpy.readthedocs.io/ en/stable/index.html scVelo v0.2.4 Bergen et al., 202010 https://scvelo.readthedocs.io/en/stable/ dropEst Petukhov et al., 201877 https://github.com/kharchenkolab/dropEst STAR 2.7.9a Dobin et al., 201378 https://github.com/alexdobin/STAR FateCompass This paper https://github.com/sarajimenez/ fatecompass https://zenodo.org/record/7974789 Other BD Fortessa LSR II Cell analyser BD Biosciences N/A FACSAria Fusion cell sorter BD Biosciences N/A Nucleofector 2b AMAXA N/A

    Article Title: Characterization of cell-fate decision landscapes by estimating transcription factor dynamics
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Sheep anti NEUROG3 R&D systems Cat#AF3444; RRID:AB_2149527 Chicken anti GFP Abcam Cat#ab13970; RRID:AB_300798 Alexa Fluor 647 Mouse anti-Nkx6-1 BD Biosciences Cat#563338; RRID: AB_2738144 Donkey anti Sheep-Alexa Fluor 647 Jackson ImmunoResearch Cat#713-605-147; RRID:AB_2340751 Donkey anti Chicken-DyLight 488 Jackson ImmunoResearch Cat#703-486-155; RRID:AB_2736851 Chemicals, peptides, and recombinant proteins TrypLE Select Thermo Fischer Scientific Cat#12563011 mTeSR1 STEMCELL Technologies Cat#85850 Matrigel Growth Factors Reduced Corning Cat#356231 Matrigel hESC-qualified Corning Cat#354277 DMEM/F12 Thermo Fischer Scientific Cat#21331020 PBS (without Ca2+ and Mg2+) Thermo Fischer Scientific Cat#14190094 MCDB 131 Thermo Fischer Scientific Cat#10372019 GlutaMAX Thermo Fischer Scientific Cat#35050038 Penicillin-Streptomycin Thermo Fischer Scientific Cat#15140130 Sodium bicarbonate Thermo Fischer Scientific Cat#25080060 D-Glucose Sigma Cat#G7021 Bovine Serum Albumin Fraction V, fatty acid free, Roche Sigma Cat#10775835001 ITS-X Thermo Fischer Scientific Cat#51500056 Y-27632 STEMCELL Technologies Cat#72304 Activin A STEMCELL Technologies Cat#78001.1 CHIR99021 Axon Medchem Cat#1386 L-Ascorbic Acid Sigma Cat#A4544 FGF7 Peprotech Cat#100-19 SANT-1 Sigma Cat#S4572 LDN193189 Stemgent Cat#04-0074 TBP (PKC act V) Millipore EMD Cat#565740 Retinoic Acid Sigma Cat#R2625 ZnSO4 Sigma Cat#Z0251 ALK5i II ENZO Cat#ALX 270 445 heparine Sigma Cat#H3149 T3 Sigma Cat#T6397 Donkey serum Jackson Immunoresearch Cat017-000-121 Paraformaldehyde 16% EUROMEDEX Cat#15710 Triton X-100 Sigma Cat#T8787 Critical commercial assays 384-well plates for scRNA SortSeq, containing ERCC spike-ins, reverse transcription primers and dNTPs, provided by Single Cell Discoveries Single Cell Discoveries N/A Human Stem Cell Nucleofector Kit 2 LONZA Cat#VPH-5022 12-well plates CellBind Corning Cat#3336 (Continued on next page) e1 Cell Reports Methods 3, 100512, July 24, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 50 mm nylon mesh NITEX Dutscher Cat#074010 50 mM sterile Filcon BD Biosciences Cat#340602 Deposited data Mouse embryonic pancreatic endocrine differentiation scRNAseq data at E15.5 Bastidas-Ponce et al., 201819 GSE132188 Time course of human in-vitro differentiation toward b-like cells scRNAseq data at stage 5 Veres et al., 201920 GSE114412 Raw scRNAseq data at PEP stage from NKX6-1-GFP/NEUROG3-HA-mCherry hiPS cell line This paper GSE202092 Experimental models: Cell lines Human: NKX6-1-GFP/NEUROG3-HA-mCherry clone#10 hiPS cells This paper N/A Human: NKX6-1-GFP (1a-21) hiPS cells Provided by C. Honoré (NovoNordisk) IMI/EU sponsored StemBANCC Gupta et al., 201875 Oligonucleotides sgRNA Fwd CACCGTGAAAGGAC CTGTCTGTCGC This paper N/A sgRNA Rev AAACGCGACAGACA GGTCCTTTCAC This paper N/A PCRwt_F CTTTGTCCGGAATCCAGCTG This paper N/A PCRwt_R CCTTACCCTTAGCACCCACA This paper N/A PCRki_F AAAGAGGGATCCTCTGACCCA This paper N/A PCRki_R ACATGAACTGAGGGGACAGG This paper N/A Recombinant DNA pX458 plasmid Addgene 48138 pBS-hNEUROG3-3HA-2A-3NLS-mCherry-pA This paper N/A Software and algorithms Dyngen v1.0.5 Cannoodt et al., 202128 https://github.com/dynverse/dyngen Scanpy v1.8.2 Wolf et al., 201876 https://scanpy.readthedocs.io/ en/stable/index.html scVelo v0.2.4 Bergen et al., 202010 https://scvelo.readthedocs.io/en/stable/ dropEst Petukhov et al., 201877 https://github.com/kharchenkolab/dropEst STAR 2.7.9a Dobin et al., 201378 https://github.com/alexdobin/STAR FateCompass This paper https://github.com/sarajimenez/ fatecompass https://zenodo.org/record/7974789 Other BD Fortessa LSR II Cell analyser BD Biosciences N/A FACSAria Fusion cell sorter BD Biosciences N/A Nucleofector 2b AMAXA N/A Article ll OPEN ACCESS

    Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice.
    Article Snippet: In brief Garg et al. use bidirectional reprogramming between embryonic stem (ES) cells and extra-embryonic endoderm (XEN) stem cells to probe transcriptional and epigenetic factors that direct lineage specification in vivo and facilitate or prevent lineage interconversions.. A strong endoderm transcriptional program and distinct epigenetic state accompany extra-embryonic endoderm specification and prevent lineage conversion.

    Article Title: The olivocerebellar system differentially encodes the effect sensory events exert on behavior.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 594 Jackson ImmunoResearch Cat# 715-585-150; RRID: AB_2340854 Calbindin D-28k Swant Cat# 300; RRID: AB_10000347 Bacterial and virus strains AAV1-CamKII-GCaMP8m Zurich Viral Vector Facility 630–1 AAV1-hSyn-dlox-RCAMP1.07 Zurich Viral Vector Facility 273–1 Chemicals, peptides, and recombinant proteins Buprenorphine (Bupaq) Streuli Pharma Swissmedic ref. A 63081; ATCVet code: QN02AE01 Carprofen (Rymadil) Zoetis Swissmedic ref. 54 ′ 375 018 Dako fluorescence mounting medium Dako S3023 DAPI Sigma-Aldrich #MBD0015 Dexamethasone (Mephameson) Mepha A75537B Sodium Pentobarbital (Esconarkon) Streuli Pharma Swissmedic ref. 55815 Isoflurane Piramal Pharma Limited Swissmedic ref. 56 ′ 761 Lidocaine Streuli Pharma Swissmedic ref. 30 ′ 015 Normal Donkey Serum Jackson ImmunoResearch #017-000-121 Paraformaldehyde Roth 0964.2 Triton X-100 Sigma-Aldrich 92046-34-9 Tween 20 Sigma-Aldrich 9005-64-5 Vectashield antifade mounting medium with DAPI Vectashield H-1200 Experimental models: Organisms/strains C57BL/6J mice Janvier Labs https://janvier-labs.com/en/fiche_produit/ 2_c57bl-6j_mouse/; RRID: IMSR_RJ: C57BL-6JRJ Pcp2-cre mice Erasmus University, bred inhouse N/A Software and algorithms Bpod State Machine r1 system Sanworks https://github.com/sanworks/Bpod; RRID: SCR_015943 Coreldraw Corel https://www.coreldraw.com/en/; RRID: SCR_013674 CaIMaN Giovannucci et al. 104 github.com/flatironinstitute/CaImAn- MATLAB ImageJ/FIJI NIH https://imagej.nih.gov/ij/; RRID: SCR_002285 Illustrator Abobe RRID: SCR_010279 Leica Application Suite (LAS) X (3.10.1.29575) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/leicalas-x-ls/; RRID: SCR_013673 MATLAB (R2022b, R2024b) MathWorks https://www.mathworks.com/; RRID: SCR_001622 MATLAB analysis code/information theory calculation Kitazawa et al. 10 ; this paper https://github.com/irinamarguerita/ ScheerPrsa_2025 NDP view2 software Hamamatsu, Nanozoomer https://nanozoomer.hamamatsu.com/jp/ en.html OASIS Friedrich et al. 105 github.com/zhoupc/OASIS_matlab (Continued on next page) Cell Reports 44, 116444, October 28, 2025 15 .. For climbing fiber imaging and behavioral experiments we used C57BL/6 mice (Janvier Labs; 2 males, 6 females, 8 to 12 weeks of age at the start of experiments).

    RNA Sequencing:

    Article Title: TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS.
    Article Snippet: Article TDP-43 dysfunction compromises UPF1-dependent mRNA metabolism in ALS Highlights • UPF1 targets in human motor neurons have GC-rich, long, structured 3′ UTRs • TDP-43 loss reduces UPF1 phosphorylation and impairs mRNA surveillance • UPF1 and TDP-43 physically interact and co-aggregate in pathological inclusions • UPF1 and TDP-43 co-regulate APA, leading to extended 3′ UTRs in neuronal mRNAs Authors Francesco Alessandrini, Matthew Wright, Tatsuaki Kurosaki, ..., Christopher J. Donnelly, Lynne E. Maquat, Evangelos Kiskinis Correspondence evangelos.kiskinis@northwestern.edu In brief Alessandrini et al. map UPF1-mediated RNA decay in human motor neurons and show that TDP-43 dysfunction impairs RNA surveillance.. UPF1 and TDP-43 proteins interact and co-aggregate in pathological inclusions; they also co- regulate alternative polyadenylation of specific transcripts extending 3′ UTRs, revealing a shared pathway underlying ALS-related RNA dysregulation.. Alessandrini et al., 2026, Neuron 114, 1–21 February 18, 2026 © 2025 The Author(s).

    other:

    Article Title: CLN3 mediates chloride efflux from lysosomes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Methanol Fisher Scientific Cat# A452SK-4 2-propanol Sigma-Aldrich Cat# 1.02781 Triton-X 100 Sigma-Aldrich Cat# X100 isoflurane Dechra N/A DMEM Thermo Fisher Scientific Cat# 10566016 Fetal Bovine Serum Thermo Fisher Scientific Cat# A5670701 TrypLETM express enzyme (1X), no phenol red Thermo Fisher Scientific Cat# 12604039 Penicillin-Streptomycin Thermo Fisher Scientific Cat# 15140122 MEM amino acids (50x) solution Sigma-Aldrich Cat# M5550 HBSS, no calcium, no magnesium, no phenol red Thermo Fisher Scientific Cat# 14175095 JetOPTIMUS DNA transfection reagent Polyplus Cat# 101000006 Polybrene Sigma-Aldrich Cat# H9268 Puromycin Sigma-Aldrich Cat# P8833 Poly-L-lysine hydrobromide Sigma Aldrich Cat# P1399 Vacuolin-1 Sigma Aldrich Cat# 673000 Nigericin (sodium salt) MedChemExpress (MCE) Cat# HY-100381 Valinomycin Sigma Aldrich Cat# 94675 Tributyltin chloride Sigma Aldrich Cat# T50202 Monensin sodium salt MedChemExpress (MCE) Cat# HY-N0150 Dimethyl sulfoxide (DMSO) Sigma Aldrich Cat# D8418 DIDS Tocris Bioscience Cat# 4523 Niflumic acid Sigma Aldrich Cat# N0630 5-Nitro-2-(3phenylpropylamino)benzoic acid Sigma Aldrich Cat# N4779 Curcumin analog C1 SelleckChem Cat# S6769 Eltrombopag MedChemExpress (MCE) Cat# HY-15306 DTT Thermo Fisher Scientific Cat# P2325 Bovine Serum Albumin (BSA) Fisher Scientific Cat# BP1600-100 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Protease inhibitor cocktail Sigma Aldrich Cat# 11873580001 Phosphatase inhibitor cocktail I Sigma Aldrich Cat# 4906845001 LDS sample buffer (4x) Thermo Fisher Scientific Cat# NP0008 PierceTM BCATM Protein Assay Thermo Fisher Scientific Cat# 23227 Intercept® (TBS) Blocking Buffer LI-COR Cat# 927-60001 20xTBS TweenTM-20 Buffer Thermo Fisher Scientific Cat# 28360 PVDF membrane Sigma Aldrich Cat# IPFL00010 TRIzolTM Reagent Thermo Fisher Scientific Cat# 15596026 RIPA This paper N/A LysoSensorTM Green DND-189 Thermo Fisher Scientific Cat# L7535 Dextran, Oregon GreenTM 488 Thermo Fisher Scientific Cat# D7170 Magic Red Cathepsin L Immunochemistry Cat# 941 DQTM-BSA red dye Thermo Fisher Scientific Cat# D12051 Dil Thermo Fisher Scientific Cat# D282 Critical commercial assays Q5® Site-Directed Mutagenesis Kit New England Biolabs Cat# E0554S GoTaq® G2 Green Master Mix Promega Cat# M7822 ClonExpress II One Step Cloning Kit Vazyme Cat# C112 2 × Phanta Flash Master Mix (Dye Plus) Vazyme Cat# P520 (Continued on next page) e2 Neuron 114, 1–16.e1–e7, March 4, 2026

    Article Title: Pre-adaptation of stem cell-derived islet organoids to hypoxia via zinc transportation inhibition drives angiogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER STZ Yeasen Cat#60256ES60 Palmitic acid Sigma-Aldrich Cat#P0500 DMSO Sigma-Aldrich Cat#D8418 SU6656 Selleck Cat#S7774 Tween80 Beyotime Cat#ST2789 ZnPTO Sigma-Aldrich Cat#H6377 Ascorbic acid Sigma-Aldrich Cat#A4544 Chir99021 Selleck Cat#S1263 BMP4 R&D Systems Cat#314-BP-01M bFGF R&D Systems Cat#233-FB-010/CF Activin A R&D Systems Cat#338-AC-01M/CF FGF-10 R&D Systems Cat#345-FG-025 Wnt3a Novoprotein Cat#C22R SANT1 Selleck Cat#S7092 Retinoic acid Sigma-Aldrich Cat#R2625 NOGGIN Novoprotein Cat#CB89 Alk5i-II Selleck Cat#S7223 LDN193189 Sigma-Aldrich Cat#SML0559 hEGF Novoprotein Cat#C029 T3 (Triiodothyronine) Selleck Cat#S5726 Trolox Selleck Cat#S3665 Bemcentinib (R428) Selleck Cat#S2841 γ-secretase inhibitor XX EMD Millipore Cat#565789 MCDB131 Sigma-Aldrich Cat#M8537 DMEM Gibco Cat#10313039 RPMI 1640 Gibco Cat#22400105 Fetal bovine serum (FBS) PAN Seratech Cat#ST30-3302 Y-27632 MedChemExpress Cat#HY-10071 TrypLE Gibco Cat#12604013 Matrigel Corning Cat#354277 Donkey serum Jackson ImmunoResearch Cat#017-000-121 L-Glutamine Gibco Cat#25030081 Bovine serum albumin (BSA) Proliant Cat#69100 Dorsomorphin (DS) MedChemExpress Cat#866405-64-3 Lificiguat (YC-1) Selleck Cat#S7958 Linoleic acid Sigma-Aldrich Cat#L1376 Stearic Acid Sigma-Aldrich Cat#S4751 Critical commercial assays HiScript II 1st Strand cDNA Synthesis Kit Vazyme Cat#R212 SuperReal SYBR Green Kit TIANGEN Cat#FP205 Enhanced BCA Protein Assay Kit Beyotime Cat#P0010 Human proinsulin ELISA kit Mercodia Cat#1118-1-10 Human ultrasensitive C-peptide ELISA kit Mercodia Cat#0111-1-10 Human insulin ELISAkit ALPCO Cat#80-INSHUU-E10 Ultrasensitive insulin ELISA ALPCO Cat#80-INSHUU-E01.1 KAPA Express Extract Kits KAPA Biosystems Cat#KK7101 Annexin V-YSFluorTM 647/PI Apoptosis Detection Kit Yeasen Cat#40304ES60 TRNzol Universal TIANGEN Cat#DP424 Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat#C2005 (Continued on next page) e2 Cell Stem Cell 33, 676–694.e1–e10, April 2, 2026

    Blocking Assay:

    Article Title: Pain hypersensitivity is dependent on autophagy protein Beclin 1 in males but not females.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies b-actin (mouse) Sigma-Aldrich Cat# A2228; RRID: AB_476697 b-actin (rabbit) Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Beclin (mouse) Abcam Cat# ab207612; RRID: AB_2692326 GluN2B (mouse) BD Transductions Cat# 610416; RRID: AB_397796 LC3B (Mouse) Cell Signaling Technology Cat# 83506; RRID: AB_2800018 SQSTM1/p62 (mouse) Abcam Cat# ab56416; RRID: AB_945626 IRDye 680RD Donkey anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68072; RRID: AB_10953628 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68070; RRID: AB_10956588 IRDye 800CW Donkey anti-Rabbit IgG Secondary Antibody LI-COR Cat# 926-32213; RRID: AB_621848 Iba1 (Rabbit) Wako Cat# 019-19741; RRID: AB_839504 GFAP (Mouse) Sigma-Aldrich Cat# G3893; RRID: AB_477010 CyTM2 AffiniPureTM Donkey Anti-Rabbit IgG Secondary Antibody Jackson ImmunoResearch Cat# 711-225-152; RRID: AB_2340612 CyTM3 AffiniPureTM Donkey Anti-Mouse IgG Secondary Antibody Jackson ImmunoResearch Cat# 715-165-150; RRID: AB_2340813 Chemicals, peptides, and recombinant proteins Tat-beclin 1 (YGRKKRRQRRRGGTN VFNATFEIWHDGEFGT) Genscript N/A Tat-scrambled (YGRKKRRQRRRGGVG NDFFINHETTGFATEW) Genscript N/A Recombinant human BDNF protein Alomone Cat# B-250 Y1036 Calbiochem Cat# 480870 BLUelf Prestained Protein Ladder Froggabio Cat# PM007-0500 Intercept (TBS) Blocking Buffer LI-COR Cat# 927-60001 ( )-Bicuculline methochloride Tocris Cat# 0131 Tetrodotoxin citrate Alomone Labs Cat# T-550 Glycine Sigma-Aldrich Cat# G5417 Strychnine Sigma-Aldrich Cat# S0532 BAPTA, Tetrapotassium Salt, cell impermeant Invitrogen Cat# B1204 Formalin Fisher chemical Cat# SF98-4 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Freund’s Adjuvant, Complete Sigma-Aldrich Cat# F5881 Protease inhibitor cocktail Set I Millipore Cat# 539131 Phosphatase inhibitor cocktail set II Millipore Cat# 524625 Poly-D-lysine hydrobromide Sigma-Aldrich Cat# P6407-5MG Neurobasal Medium Gibco Cat# 21103-049 Hanks Balanced Salt Solution Gibco Cat# 24020-117 B-27 Supplement Gibco Cat# 17504-044 L-Glutamine Gibco Cat# 25030-081 Fetal Bovine Serum Gibco Cat# 26140-079 (Continued on next page) 12 Cell Reports 43, 114293, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ADVANCED DNA Fast Extract Kit Wisent Cat# 801-200-DR ADVANCED 2X HS-Red Taq PCR Mastermix Wisent Cat# 801-200-MM Pierce BCA Protein Assay Reagent A Thermo Scientific Cat# PI23223 Pierce BCA Protein Assay Reagent B Thermo Scientific Cat# PI23224 Experimental models: Organisms/strains C57BL/6J mice Jackson Laboratory C57BL/6J Wistar rats Charles River N/A Becn1loxP Yeganeh et al.11 C57BL/6NTac-Becn1tm1a(KOMP)Wtsi/ Cnrm X B6; SJL-Tg(ACTFLPe)9205Dym/J CMV-cre mice Jackson Laboratory B6.C-Tg(CMV-cre)1Cgn/J Becn1F121A Rocchi et al.24 B6.129(Cg)-Becn1tm2.1Blev/J Oligonucleotides Becn1 knockout genotyping primer set Integrated DNA Technologies Table S1 Becn1F121A genotyping primer set Integrated DNA Technologies Table S1 Software and algorithms Image Studio 5.2 LI-COR https://www.licor.com/bio/image-studio/ Prism 9 GraphPad Software https://www.graphpad.com/ Clampex 10.7 and Clampfit 10.7 Molecular Devices https://support.moleculardevices.com/s/ article/Axon-pCLAMP-10Electrophysiology-Data-AcquisitionAnalysis-Software-Download-Page Mini Analysis Program 6.0 Synaptosoft RRID:SCR_002184 CaseViewer 2.4 3DHISTECH https://www.3dhistech.com/solutions/ caseviewer/ BioRender BioRender https://www.biorender.com/

    Adjuvant:

    Article Title: Pain hypersensitivity is dependent on autophagy protein Beclin 1 in males but not females.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies b-actin (mouse) Sigma-Aldrich Cat# A2228; RRID: AB_476697 b-actin (rabbit) Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Beclin (mouse) Abcam Cat# ab207612; RRID: AB_2692326 GluN2B (mouse) BD Transductions Cat# 610416; RRID: AB_397796 LC3B (Mouse) Cell Signaling Technology Cat# 83506; RRID: AB_2800018 SQSTM1/p62 (mouse) Abcam Cat# ab56416; RRID: AB_945626 IRDye 680RD Donkey anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68072; RRID: AB_10953628 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68070; RRID: AB_10956588 IRDye 800CW Donkey anti-Rabbit IgG Secondary Antibody LI-COR Cat# 926-32213; RRID: AB_621848 Iba1 (Rabbit) Wako Cat# 019-19741; RRID: AB_839504 GFAP (Mouse) Sigma-Aldrich Cat# G3893; RRID: AB_477010 CyTM2 AffiniPureTM Donkey Anti-Rabbit IgG Secondary Antibody Jackson ImmunoResearch Cat# 711-225-152; RRID: AB_2340612 CyTM3 AffiniPureTM Donkey Anti-Mouse IgG Secondary Antibody Jackson ImmunoResearch Cat# 715-165-150; RRID: AB_2340813 Chemicals, peptides, and recombinant proteins Tat-beclin 1 (YGRKKRRQRRRGGTN VFNATFEIWHDGEFGT) Genscript N/A Tat-scrambled (YGRKKRRQRRRGGVG NDFFINHETTGFATEW) Genscript N/A Recombinant human BDNF protein Alomone Cat# B-250 Y1036 Calbiochem Cat# 480870 BLUelf Prestained Protein Ladder Froggabio Cat# PM007-0500 Intercept (TBS) Blocking Buffer LI-COR Cat# 927-60001 ( )-Bicuculline methochloride Tocris Cat# 0131 Tetrodotoxin citrate Alomone Labs Cat# T-550 Glycine Sigma-Aldrich Cat# G5417 Strychnine Sigma-Aldrich Cat# S0532 BAPTA, Tetrapotassium Salt, cell impermeant Invitrogen Cat# B1204 Formalin Fisher chemical Cat# SF98-4 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Freund’s Adjuvant, Complete Sigma-Aldrich Cat# F5881 Protease inhibitor cocktail Set I Millipore Cat# 539131 Phosphatase inhibitor cocktail set II Millipore Cat# 524625 Poly-D-lysine hydrobromide Sigma-Aldrich Cat# P6407-5MG Neurobasal Medium Gibco Cat# 21103-049 Hanks Balanced Salt Solution Gibco Cat# 24020-117 B-27 Supplement Gibco Cat# 17504-044 L-Glutamine Gibco Cat# 25030-081 Fetal Bovine Serum Gibco Cat# 26140-079 (Continued on next page) 12 Cell Reports 43, 114293, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ADVANCED DNA Fast Extract Kit Wisent Cat# 801-200-DR ADVANCED 2X HS-Red Taq PCR Mastermix Wisent Cat# 801-200-MM Pierce BCA Protein Assay Reagent A Thermo Scientific Cat# PI23223 Pierce BCA Protein Assay Reagent B Thermo Scientific Cat# PI23224 Experimental models: Organisms/strains C57BL/6J mice Jackson Laboratory C57BL/6J Wistar rats Charles River N/A Becn1loxP Yeganeh et al.11 C57BL/6NTac-Becn1tm1a(KOMP)Wtsi/ Cnrm X B6; SJL-Tg(ACTFLPe)9205Dym/J CMV-cre mice Jackson Laboratory B6.C-Tg(CMV-cre)1Cgn/J Becn1F121A Rocchi et al.24 B6.129(Cg)-Becn1tm2.1Blev/J Oligonucleotides Becn1 knockout genotyping primer set Integrated DNA Technologies Table S1 Becn1F121A genotyping primer set Integrated DNA Technologies Table S1 Software and algorithms Image Studio 5.2 LI-COR https://www.licor.com/bio/image-studio/ Prism 9 GraphPad Software https://www.graphpad.com/ Clampex 10.7 and Clampfit 10.7 Molecular Devices https://support.moleculardevices.com/s/ article/Axon-pCLAMP-10Electrophysiology-Data-AcquisitionAnalysis-Software-Download-Page Mini Analysis Program 6.0 Synaptosoft RRID:SCR_002184 CaseViewer 2.4 3DHISTECH https://www.3dhistech.com/solutions/ caseviewer/ BioRender BioRender https://www.biorender.com/

    Protease Inhibitor:

    Article Title: Pain hypersensitivity is dependent on autophagy protein Beclin 1 in males but not females.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies b-actin (mouse) Sigma-Aldrich Cat# A2228; RRID: AB_476697 b-actin (rabbit) Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Beclin (mouse) Abcam Cat# ab207612; RRID: AB_2692326 GluN2B (mouse) BD Transductions Cat# 610416; RRID: AB_397796 LC3B (Mouse) Cell Signaling Technology Cat# 83506; RRID: AB_2800018 SQSTM1/p62 (mouse) Abcam Cat# ab56416; RRID: AB_945626 IRDye 680RD Donkey anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68072; RRID: AB_10953628 IRDye 680RD Goat anti-Mouse IgG Secondary Antibody LI-COR Cat# 926-68070; RRID: AB_10956588 IRDye 800CW Donkey anti-Rabbit IgG Secondary Antibody LI-COR Cat# 926-32213; RRID: AB_621848 Iba1 (Rabbit) Wako Cat# 019-19741; RRID: AB_839504 GFAP (Mouse) Sigma-Aldrich Cat# G3893; RRID: AB_477010 CyTM2 AffiniPureTM Donkey Anti-Rabbit IgG Secondary Antibody Jackson ImmunoResearch Cat# 711-225-152; RRID: AB_2340612 CyTM3 AffiniPureTM Donkey Anti-Mouse IgG Secondary Antibody Jackson ImmunoResearch Cat# 715-165-150; RRID: AB_2340813 Chemicals, peptides, and recombinant proteins Tat-beclin 1 (YGRKKRRQRRRGGTN VFNATFEIWHDGEFGT) Genscript N/A Tat-scrambled (YGRKKRRQRRRGGVG NDFFINHETTGFATEW) Genscript N/A Recombinant human BDNF protein Alomone Cat# B-250 Y1036 Calbiochem Cat# 480870 BLUelf Prestained Protein Ladder Froggabio Cat# PM007-0500 Intercept (TBS) Blocking Buffer LI-COR Cat# 927-60001 ( )-Bicuculline methochloride Tocris Cat# 0131 Tetrodotoxin citrate Alomone Labs Cat# T-550 Glycine Sigma-Aldrich Cat# G5417 Strychnine Sigma-Aldrich Cat# S0532 BAPTA, Tetrapotassium Salt, cell impermeant Invitrogen Cat# B1204 Formalin Fisher chemical Cat# SF98-4 Normal Donkey Serum Jackson ImmunoResearch Cat# 017-000-121 Freund’s Adjuvant, Complete Sigma-Aldrich Cat# F5881 Protease inhibitor cocktail Set I Millipore Cat# 539131 Phosphatase inhibitor cocktail set II Millipore Cat# 524625 Poly-D-lysine hydrobromide Sigma-Aldrich Cat# P6407-5MG Neurobasal Medium Gibco Cat# 21103-049 Hanks Balanced Salt Solution Gibco Cat# 24020-117 B-27 Supplement Gibco Cat# 17504-044 L-Glutamine Gibco Cat# 25030-081 Fetal Bovine Serum Gibco Cat# 26140-079 (Continued on next page) 12 Cell Reports 43, 114293, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ADVANCED DNA Fast Extract Kit Wisent Cat# 801-200-DR ADVANCED 2X HS-Red Taq PCR Mastermix Wisent Cat# 801-200-MM Pierce BCA Protein Assay Reagent A Thermo Scientific Cat# PI23223 Pierce BCA Protein Assay Reagent B Thermo Scientific Cat# PI23224 Experimental models: Organisms/strains C57BL/6J mice Jackson Laboratory C57BL/6J Wistar rats Charles River N/A Becn1loxP Yeganeh et al.11 C57BL/6NTac-Becn1tm1a(KOMP)Wtsi/ Cnrm X B6; SJL-Tg(ACTFLPe)9205Dym/J CMV-cre mice Jackson Laboratory B6.C-Tg(CMV-cre)1Cgn/J Becn1F121A Rocchi et al.24 B6.129(Cg)-Becn1tm2.1Blev/J Oligonucleotides Becn1 knockout genotyping primer set Integrated DNA Technologies Table S1 Becn1F121A genotyping primer set Integrated DNA Technologies Table S1 Software and algorithms Image Studio 5.2 LI-COR https://www.licor.com/bio/image-studio/ Prism 9 GraphPad Software https://www.graphpad.com/ Clampex 10.7 and Clampfit 10.7 Molecular Devices https://support.moleculardevices.com/s/ article/Axon-pCLAMP-10Electrophysiology-Data-AcquisitionAnalysis-Software-Download-Page Mini Analysis Program 6.0 Synaptosoft RRID:SCR_002184 CaseViewer 2.4 3DHISTECH https://www.3dhistech.com/solutions/ caseviewer/ BioRender BioRender https://www.biorender.com/

    Reverse Transcription:

    Article Title: Characterization of cell-fate decision landscapes by estimating transcription factor dynamics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Sheep anti NEUROG3 R&D systems Cat#AF3444; RRID:AB_2149527 Chicken anti GFP Abcam Cat#ab13970; RRID:AB_300798 Alexa Fluor 647 Mouse anti-Nkx6-1 BD Biosciences Cat#563338; RRID: AB_2738144 Donkey anti Sheep-Alexa Fluor 647 Jackson ImmunoResearch Cat#713-605-147; RRID:AB_2340751 Donkey anti Chicken-DyLight 488 Jackson ImmunoResearch Cat#703-486-155; RRID:AB_2736851 Chemicals, peptides, and recombinant proteins TrypLE Select Thermo Fischer Scientific Cat#12563011 mTeSR1 STEMCELL Technologies Cat#85850 Matrigel Growth Factors Reduced Corning Cat#356231 Matrigel hESC-qualified Corning Cat#354277 DMEM/F12 Thermo Fischer Scientific Cat#21331020 PBS (without Ca2+ and Mg2+) Thermo Fischer Scientific Cat#14190094 MCDB 131 Thermo Fischer Scientific Cat#10372019 GlutaMAX Thermo Fischer Scientific Cat#35050038 Penicillin-Streptomycin Thermo Fischer Scientific Cat#15140130 Sodium bicarbonate Thermo Fischer Scientific Cat#25080060 D-Glucose Sigma Cat#G7021 Bovine Serum Albumin Fraction V, fatty acid free, Roche Sigma Cat#10775835001 ITS-X Thermo Fischer Scientific Cat#51500056 Y-27632 STEMCELL Technologies Cat#72304 Activin A STEMCELL Technologies Cat#78001.1 CHIR99021 Axon Medchem Cat#1386 L-Ascorbic Acid Sigma Cat#A4544 FGF7 Peprotech Cat#100-19 SANT-1 Sigma Cat#S4572 LDN193189 Stemgent Cat#04-0074 TBP (PKC act V) Millipore EMD Cat#565740 Retinoic Acid Sigma Cat#R2625 ZnSO4 Sigma Cat#Z0251 ALK5i II ENZO Cat#ALX 270 445 heparine Sigma Cat#H3149 T3 Sigma Cat#T6397 Donkey serum Jackson Immunoresearch Cat017-000-121 Paraformaldehyde 16% EUROMEDEX Cat#15710 Triton X-100 Sigma Cat#T8787 Critical commercial assays 384-well plates for scRNA SortSeq, containing ERCC spike-ins, reverse transcription primers and dNTPs, provided by Single Cell Discoveries Single Cell Discoveries N/A Human Stem Cell Nucleofector Kit 2 LONZA Cat#VPH-5022 12-well plates CellBind Corning Cat#3336 (Continued on next page) e1 Cell Reports Methods 3, 100512, July 24, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 50 mm nylon mesh NITEX Dutscher Cat#074010 50 mM sterile Filcon BD Biosciences Cat#340602 Deposited data Mouse embryonic pancreatic endocrine differentiation scRNAseq data at E15.5 Bastidas-Ponce et al., 201819 GSE132188 Time course of human in-vitro differentiation toward b-like cells scRNAseq data at stage 5 Veres et al., 201920 GSE114412 Raw scRNAseq data at PEP stage from NKX6-1-GFP/NEUROG3-HA-mCherry hiPS cell line This paper GSE202092 Experimental models: Cell lines Human: NKX6-1-GFP/NEUROG3-HA-mCherry clone#10 hiPS cells This paper N/A Human: NKX6-1-GFP (1a-21) hiPS cells Provided by C. Honoré (NovoNordisk) IMI/EU sponsored StemBANCC Gupta et al., 201875 Oligonucleotides sgRNA Fwd CACCGTGAAAGGAC CTGTCTGTCGC This paper N/A sgRNA Rev AAACGCGACAGACA GGTCCTTTCAC This paper N/A PCRwt_F CTTTGTCCGGAATCCAGCTG This paper N/A PCRwt_R CCTTACCCTTAGCACCCACA This paper N/A PCRki_F AAAGAGGGATCCTCTGACCCA This paper N/A PCRki_R ACATGAACTGAGGGGACAGG This paper N/A Recombinant DNA pX458 plasmid Addgene 48138 pBS-hNEUROG3-3HA-2A-3NLS-mCherry-pA This paper N/A Software and algorithms Dyngen v1.0.5 Cannoodt et al., 202128 https://github.com/dynverse/dyngen Scanpy v1.8.2 Wolf et al., 201876 https://scanpy.readthedocs.io/ en/stable/index.html scVelo v0.2.4 Bergen et al., 202010 https://scvelo.readthedocs.io/en/stable/ dropEst Petukhov et al., 201877 https://github.com/kharchenkolab/dropEst STAR 2.7.9a Dobin et al., 201378 https://github.com/alexdobin/STAR FateCompass This paper https://github.com/sarajimenez/ fatecompass https://zenodo.org/record/7974789 Other BD Fortessa LSR II Cell analyser BD Biosciences N/A FACSAria Fusion cell sorter BD Biosciences N/A Nucleofector 2b AMAXA N/A

    Article Title: Characterization of cell-fate decision landscapes by estimating transcription factor dynamics
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Sheep anti NEUROG3 R&D systems Cat#AF3444; RRID:AB_2149527 Chicken anti GFP Abcam Cat#ab13970; RRID:AB_300798 Alexa Fluor 647 Mouse anti-Nkx6-1 BD Biosciences Cat#563338; RRID: AB_2738144 Donkey anti Sheep-Alexa Fluor 647 Jackson ImmunoResearch Cat#713-605-147; RRID:AB_2340751 Donkey anti Chicken-DyLight 488 Jackson ImmunoResearch Cat#703-486-155; RRID:AB_2736851 Chemicals, peptides, and recombinant proteins TrypLE Select Thermo Fischer Scientific Cat#12563011 mTeSR1 STEMCELL Technologies Cat#85850 Matrigel Growth Factors Reduced Corning Cat#356231 Matrigel hESC-qualified Corning Cat#354277 DMEM/F12 Thermo Fischer Scientific Cat#21331020 PBS (without Ca2+ and Mg2+) Thermo Fischer Scientific Cat#14190094 MCDB 131 Thermo Fischer Scientific Cat#10372019 GlutaMAX Thermo Fischer Scientific Cat#35050038 Penicillin-Streptomycin Thermo Fischer Scientific Cat#15140130 Sodium bicarbonate Thermo Fischer Scientific Cat#25080060 D-Glucose Sigma Cat#G7021 Bovine Serum Albumin Fraction V, fatty acid free, Roche Sigma Cat#10775835001 ITS-X Thermo Fischer Scientific Cat#51500056 Y-27632 STEMCELL Technologies Cat#72304 Activin A STEMCELL Technologies Cat#78001.1 CHIR99021 Axon Medchem Cat#1386 L-Ascorbic Acid Sigma Cat#A4544 FGF7 Peprotech Cat#100-19 SANT-1 Sigma Cat#S4572 LDN193189 Stemgent Cat#04-0074 TBP (PKC act V) Millipore EMD Cat#565740 Retinoic Acid Sigma Cat#R2625 ZnSO4 Sigma Cat#Z0251 ALK5i II ENZO Cat#ALX 270 445 heparine Sigma Cat#H3149 T3 Sigma Cat#T6397 Donkey serum Jackson Immunoresearch Cat017-000-121 Paraformaldehyde 16% EUROMEDEX Cat#15710 Triton X-100 Sigma Cat#T8787 Critical commercial assays 384-well plates for scRNA SortSeq, containing ERCC spike-ins, reverse transcription primers and dNTPs, provided by Single Cell Discoveries Single Cell Discoveries N/A Human Stem Cell Nucleofector Kit 2 LONZA Cat#VPH-5022 12-well plates CellBind Corning Cat#3336 (Continued on next page) e1 Cell Reports Methods 3, 100512, July 24, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 50 mm nylon mesh NITEX Dutscher Cat#074010 50 mM sterile Filcon BD Biosciences Cat#340602 Deposited data Mouse embryonic pancreatic endocrine differentiation scRNAseq data at E15.5 Bastidas-Ponce et al., 201819 GSE132188 Time course of human in-vitro differentiation toward b-like cells scRNAseq data at stage 5 Veres et al., 201920 GSE114412 Raw scRNAseq data at PEP stage from NKX6-1-GFP/NEUROG3-HA-mCherry hiPS cell line This paper GSE202092 Experimental models: Cell lines Human: NKX6-1-GFP/NEUROG3-HA-mCherry clone#10 hiPS cells This paper N/A Human: NKX6-1-GFP (1a-21) hiPS cells Provided by C. Honoré (NovoNordisk) IMI/EU sponsored StemBANCC Gupta et al., 201875 Oligonucleotides sgRNA Fwd CACCGTGAAAGGAC CTGTCTGTCGC This paper N/A sgRNA Rev AAACGCGACAGACA GGTCCTTTCAC This paper N/A PCRwt_F CTTTGTCCGGAATCCAGCTG This paper N/A PCRwt_R CCTTACCCTTAGCACCCACA This paper N/A PCRki_F AAAGAGGGATCCTCTGACCCA This paper N/A PCRki_R ACATGAACTGAGGGGACAGG This paper N/A Recombinant DNA pX458 plasmid Addgene 48138 pBS-hNEUROG3-3HA-2A-3NLS-mCherry-pA This paper N/A Software and algorithms Dyngen v1.0.5 Cannoodt et al., 202128 https://github.com/dynverse/dyngen Scanpy v1.8.2 Wolf et al., 201876 https://scanpy.readthedocs.io/ en/stable/index.html scVelo v0.2.4 Bergen et al., 202010 https://scvelo.readthedocs.io/en/stable/ dropEst Petukhov et al., 201877 https://github.com/kharchenkolab/dropEst STAR 2.7.9a Dobin et al., 201378 https://github.com/alexdobin/STAR FateCompass This paper https://github.com/sarajimenez/ fatecompass https://zenodo.org/record/7974789 Other BD Fortessa LSR II Cell analyser BD Biosciences N/A FACSAria Fusion cell sorter BD Biosciences N/A Nucleofector 2b AMAXA N/A Article ll OPEN ACCESS

    Single Cell:

    Article Title: Characterization of cell-fate decision landscapes by estimating transcription factor dynamics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Sheep anti NEUROG3 R&D systems Cat#AF3444; RRID:AB_2149527 Chicken anti GFP Abcam Cat#ab13970; RRID:AB_300798 Alexa Fluor 647 Mouse anti-Nkx6-1 BD Biosciences Cat#563338; RRID: AB_2738144 Donkey anti Sheep-Alexa Fluor 647 Jackson ImmunoResearch Cat#713-605-147; RRID:AB_2340751 Donkey anti Chicken-DyLight 488 Jackson ImmunoResearch Cat#703-486-155; RRID:AB_2736851 Chemicals, peptides, and recombinant proteins TrypLE Select Thermo Fischer Scientific Cat#12563011 mTeSR1 STEMCELL Technologies Cat#85850 Matrigel Growth Factors Reduced Corning Cat#356231 Matrigel hESC-qualified Corning Cat#354277 DMEM/F12 Thermo Fischer Scientific Cat#21331020 PBS (without Ca2+ and Mg2+) Thermo Fischer Scientific Cat#14190094 MCDB 131 Thermo Fischer Scientific Cat#10372019 GlutaMAX Thermo Fischer Scientific Cat#35050038 Penicillin-Streptomycin Thermo Fischer Scientific Cat#15140130 Sodium bicarbonate Thermo Fischer Scientific Cat#25080060 D-Glucose Sigma Cat#G7021 Bovine Serum Albumin Fraction V, fatty acid free, Roche Sigma Cat#10775835001 ITS-X Thermo Fischer Scientific Cat#51500056 Y-27632 STEMCELL Technologies Cat#72304 Activin A STEMCELL Technologies Cat#78001.1 CHIR99021 Axon Medchem Cat#1386 L-Ascorbic Acid Sigma Cat#A4544 FGF7 Peprotech Cat#100-19 SANT-1 Sigma Cat#S4572 LDN193189 Stemgent Cat#04-0074 TBP (PKC act V) Millipore EMD Cat#565740 Retinoic Acid Sigma Cat#R2625 ZnSO4 Sigma Cat#Z0251 ALK5i II ENZO Cat#ALX 270 445 heparine Sigma Cat#H3149 T3 Sigma Cat#T6397 Donkey serum Jackson Immunoresearch Cat017-000-121 Paraformaldehyde 16% EUROMEDEX Cat#15710 Triton X-100 Sigma Cat#T8787 Critical commercial assays 384-well plates for scRNA SortSeq, containing ERCC spike-ins, reverse transcription primers and dNTPs, provided by Single Cell Discoveries Single Cell Discoveries N/A Human Stem Cell Nucleofector Kit 2 LONZA Cat#VPH-5022 12-well plates CellBind Corning Cat#3336 (Continued on next page) e1 Cell Reports Methods 3, 100512, July 24, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 50 mm nylon mesh NITEX Dutscher Cat#074010 50 mM sterile Filcon BD Biosciences Cat#340602 Deposited data Mouse embryonic pancreatic endocrine differentiation scRNAseq data at E15.5 Bastidas-Ponce et al., 201819 GSE132188 Time course of human in-vitro differentiation toward b-like cells scRNAseq data at stage 5 Veres et al., 201920 GSE114412 Raw scRNAseq data at PEP stage from NKX6-1-GFP/NEUROG3-HA-mCherry hiPS cell line This paper GSE202092 Experimental models: Cell lines Human: NKX6-1-GFP/NEUROG3-HA-mCherry clone#10 hiPS cells This paper N/A Human: NKX6-1-GFP (1a-21) hiPS cells Provided by C. Honoré (NovoNordisk) IMI/EU sponsored StemBANCC Gupta et al., 201875 Oligonucleotides sgRNA Fwd CACCGTGAAAGGAC CTGTCTGTCGC This paper N/A sgRNA Rev AAACGCGACAGACA GGTCCTTTCAC This paper N/A PCRwt_F CTTTGTCCGGAATCCAGCTG This paper N/A PCRwt_R CCTTACCCTTAGCACCCACA This paper N/A PCRki_F AAAGAGGGATCCTCTGACCCA This paper N/A PCRki_R ACATGAACTGAGGGGACAGG This paper N/A Recombinant DNA pX458 plasmid Addgene 48138 pBS-hNEUROG3-3HA-2A-3NLS-mCherry-pA This paper N/A Software and algorithms Dyngen v1.0.5 Cannoodt et al., 202128 https://github.com/dynverse/dyngen Scanpy v1.8.2 Wolf et al., 201876 https://scanpy.readthedocs.io/ en/stable/index.html scVelo v0.2.4 Bergen et al., 202010 https://scvelo.readthedocs.io/en/stable/ dropEst Petukhov et al., 201877 https://github.com/kharchenkolab/dropEst STAR 2.7.9a Dobin et al., 201378 https://github.com/alexdobin/STAR FateCompass This paper https://github.com/sarajimenez/ fatecompass https://zenodo.org/record/7974789 Other BD Fortessa LSR II Cell analyser BD Biosciences N/A FACSAria Fusion cell sorter BD Biosciences N/A Nucleofector 2b AMAXA N/A

    Article Title: Characterization of cell-fate decision landscapes by estimating transcription factor dynamics
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Sheep anti NEUROG3 R&D systems Cat#AF3444; RRID:AB_2149527 Chicken anti GFP Abcam Cat#ab13970; RRID:AB_300798 Alexa Fluor 647 Mouse anti-Nkx6-1 BD Biosciences Cat#563338; RRID: AB_2738144 Donkey anti Sheep-Alexa Fluor 647 Jackson ImmunoResearch Cat#713-605-147; RRID:AB_2340751 Donkey anti Chicken-DyLight 488 Jackson ImmunoResearch Cat#703-486-155; RRID:AB_2736851 Chemicals, peptides, and recombinant proteins TrypLE Select Thermo Fischer Scientific Cat#12563011 mTeSR1 STEMCELL Technologies Cat#85850 Matrigel Growth Factors Reduced Corning Cat#356231 Matrigel hESC-qualified Corning Cat#354277 DMEM/F12 Thermo Fischer Scientific Cat#21331020 PBS (without Ca2+ and Mg2+) Thermo Fischer Scientific Cat#14190094 MCDB 131 Thermo Fischer Scientific Cat#10372019 GlutaMAX Thermo Fischer Scientific Cat#35050038 Penicillin-Streptomycin Thermo Fischer Scientific Cat#15140130 Sodium bicarbonate Thermo Fischer Scientific Cat#25080060 D-Glucose Sigma Cat#G7021 Bovine Serum Albumin Fraction V, fatty acid free, Roche Sigma Cat#10775835001 ITS-X Thermo Fischer Scientific Cat#51500056 Y-27632 STEMCELL Technologies Cat#72304 Activin A STEMCELL Technologies Cat#78001.1 CHIR99021 Axon Medchem Cat#1386 L-Ascorbic Acid Sigma Cat#A4544 FGF7 Peprotech Cat#100-19 SANT-1 Sigma Cat#S4572 LDN193189 Stemgent Cat#04-0074 TBP (PKC act V) Millipore EMD Cat#565740 Retinoic Acid Sigma Cat#R2625 ZnSO4 Sigma Cat#Z0251 ALK5i II ENZO Cat#ALX 270 445 heparine Sigma Cat#H3149 T3 Sigma Cat#T6397 Donkey serum Jackson Immunoresearch Cat017-000-121 Paraformaldehyde 16% EUROMEDEX Cat#15710 Triton X-100 Sigma Cat#T8787 Critical commercial assays 384-well plates for scRNA SortSeq, containing ERCC spike-ins, reverse transcription primers and dNTPs, provided by Single Cell Discoveries Single Cell Discoveries N/A Human Stem Cell Nucleofector Kit 2 LONZA Cat#VPH-5022 12-well plates CellBind Corning Cat#3336 (Continued on next page) e1 Cell Reports Methods 3, 100512, July 24, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 50 mm nylon mesh NITEX Dutscher Cat#074010 50 mM sterile Filcon BD Biosciences Cat#340602 Deposited data Mouse embryonic pancreatic endocrine differentiation scRNAseq data at E15.5 Bastidas-Ponce et al., 201819 GSE132188 Time course of human in-vitro differentiation toward b-like cells scRNAseq data at stage 5 Veres et al., 201920 GSE114412 Raw scRNAseq data at PEP stage from NKX6-1-GFP/NEUROG3-HA-mCherry hiPS cell line This paper GSE202092 Experimental models: Cell lines Human: NKX6-1-GFP/NEUROG3-HA-mCherry clone#10 hiPS cells This paper N/A Human: NKX6-1-GFP (1a-21) hiPS cells Provided by C. Honoré (NovoNordisk) IMI/EU sponsored StemBANCC Gupta et al., 201875 Oligonucleotides sgRNA Fwd CACCGTGAAAGGAC CTGTCTGTCGC This paper N/A sgRNA Rev AAACGCGACAGACA GGTCCTTTCAC This paper N/A PCRwt_F CTTTGTCCGGAATCCAGCTG This paper N/A PCRwt_R CCTTACCCTTAGCACCCACA This paper N/A PCRki_F AAAGAGGGATCCTCTGACCCA This paper N/A PCRki_R ACATGAACTGAGGGGACAGG This paper N/A Recombinant DNA pX458 plasmid Addgene 48138 pBS-hNEUROG3-3HA-2A-3NLS-mCherry-pA This paper N/A Software and algorithms Dyngen v1.0.5 Cannoodt et al., 202128 https://github.com/dynverse/dyngen Scanpy v1.8.2 Wolf et al., 201876 https://scanpy.readthedocs.io/ en/stable/index.html scVelo v0.2.4 Bergen et al., 202010 https://scvelo.readthedocs.io/en/stable/ dropEst Petukhov et al., 201877 https://github.com/kharchenkolab/dropEst STAR 2.7.9a Dobin et al., 201378 https://github.com/alexdobin/STAR FateCompass This paper https://github.com/sarajimenez/ fatecompass https://zenodo.org/record/7974789 Other BD Fortessa LSR II Cell analyser BD Biosciences N/A FACSAria Fusion cell sorter BD Biosciences N/A Nucleofector 2b AMAXA N/A Article ll OPEN ACCESS

    Negative Control:

    Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice.
    Article Snippet: In brief Garg et al. use bidirectional reprogramming between embryonic stem (ES) cells and extra-embryonic endoderm (XEN) stem cells to probe transcriptional and epigenetic factors that direct lineage specification in vivo and facilitate or prevent lineage interconversions.. A strong endoderm transcriptional program and distinct epigenetic state accompany extra-embryonic endoderm specification and prevent lineage conversion.

    Virus:

    Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice.
    Article Snippet: In brief Garg et al. use bidirectional reprogramming between embryonic stem (ES) cells and extra-embryonic endoderm (XEN) stem cells to probe transcriptional and epigenetic factors that direct lineage specification in vivo and facilitate or prevent lineage interconversions.. A strong endoderm transcriptional program and distinct epigenetic state accompany extra-embryonic endoderm specification and prevent lineage conversion.

    Article Title: The olivocerebellar system differentially encodes the effect sensory events exert on behavior.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 594 Jackson ImmunoResearch Cat# 715-585-150; RRID: AB_2340854 Calbindin D-28k Swant Cat# 300; RRID: AB_10000347 Bacterial and virus strains AAV1-CamKII-GCaMP8m Zurich Viral Vector Facility 630–1 AAV1-hSyn-dlox-RCAMP1.07 Zurich Viral Vector Facility 273–1 Chemicals, peptides, and recombinant proteins Buprenorphine (Bupaq) Streuli Pharma Swissmedic ref. A 63081; ATCVet code: QN02AE01 Carprofen (Rymadil) Zoetis Swissmedic ref. 54 ′ 375 018 Dako fluorescence mounting medium Dako S3023 DAPI Sigma-Aldrich #MBD0015 Dexamethasone (Mephameson) Mepha A75537B Sodium Pentobarbital (Esconarkon) Streuli Pharma Swissmedic ref. 55815 Isoflurane Piramal Pharma Limited Swissmedic ref. 56 ′ 761 Lidocaine Streuli Pharma Swissmedic ref. 30 ′ 015 Normal Donkey Serum Jackson ImmunoResearch #017-000-121 Paraformaldehyde Roth 0964.2 Triton X-100 Sigma-Aldrich 92046-34-9 Tween 20 Sigma-Aldrich 9005-64-5 Vectashield antifade mounting medium with DAPI Vectashield H-1200 Experimental models: Organisms/strains C57BL/6J mice Janvier Labs https://janvier-labs.com/en/fiche_produit/ 2_c57bl-6j_mouse/; RRID: IMSR_RJ: C57BL-6JRJ Pcp2-cre mice Erasmus University, bred inhouse N/A Software and algorithms Bpod State Machine r1 system Sanworks https://github.com/sanworks/Bpod; RRID: SCR_015943 Coreldraw Corel https://www.coreldraw.com/en/; RRID: SCR_013674 CaIMaN Giovannucci et al. 104 github.com/flatironinstitute/CaImAn- MATLAB ImageJ/FIJI NIH https://imagej.nih.gov/ij/; RRID: SCR_002285 Illustrator Abobe RRID: SCR_010279 Leica Application Suite (LAS) X (3.10.1.29575) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/leicalas-x-ls/; RRID: SCR_013673 MATLAB (R2022b, R2024b) MathWorks https://www.mathworks.com/; RRID: SCR_001622 MATLAB analysis code/information theory calculation Kitazawa et al. 10 ; this paper https://github.com/irinamarguerita/ ScheerPrsa_2025 NDP view2 software Hamamatsu, Nanozoomer https://nanozoomer.hamamatsu.com/jp/ en.html OASIS Friedrich et al. 105 github.com/zhoupc/OASIS_matlab (Continued on next page) Cell Reports 44, 116444, October 28, 2025 15 .. For climbing fiber imaging and behavioral experiments we used C57BL/6 mice (Janvier Labs; 2 males, 6 females, 8 to 12 weeks of age at the start of experiments).

    Electron Microscopy:

    Article Title: Single-cell analysis of bidirectional reprogramming between early embryonic states identify mechanisms of differential lineage plasticities in mice.
    Article Snippet: In brief Garg et al. use bidirectional reprogramming between embryonic stem (ES) cells and extra-embryonic endoderm (XEN) stem cells to probe transcriptional and epigenetic factors that direct lineage specification in vivo and facilitate or prevent lineage interconversions.. A strong endoderm transcriptional program and distinct epigenetic state accompany extra-embryonic endoderm specification and prevent lineage conversion.

    Fluorescence:

    Article Title: The olivocerebellar system differentially encodes the effect sensory events exert on behavior.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 594 Jackson ImmunoResearch Cat# 715-585-150; RRID: AB_2340854 Calbindin D-28k Swant Cat# 300; RRID: AB_10000347 Bacterial and virus strains AAV1-CamKII-GCaMP8m Zurich Viral Vector Facility 630–1 AAV1-hSyn-dlox-RCAMP1.07 Zurich Viral Vector Facility 273–1 Chemicals, peptides, and recombinant proteins Buprenorphine (Bupaq) Streuli Pharma Swissmedic ref. A 63081; ATCVet code: QN02AE01 Carprofen (Rymadil) Zoetis Swissmedic ref. 54 ′ 375 018 Dako fluorescence mounting medium Dako S3023 DAPI Sigma-Aldrich #MBD0015 Dexamethasone (Mephameson) Mepha A75537B Sodium Pentobarbital (Esconarkon) Streuli Pharma Swissmedic ref. 55815 Isoflurane Piramal Pharma Limited Swissmedic ref. 56 ′ 761 Lidocaine Streuli Pharma Swissmedic ref. 30 ′ 015 Normal Donkey Serum Jackson ImmunoResearch #017-000-121 Paraformaldehyde Roth 0964.2 Triton X-100 Sigma-Aldrich 92046-34-9 Tween 20 Sigma-Aldrich 9005-64-5 Vectashield antifade mounting medium with DAPI Vectashield H-1200 Experimental models: Organisms/strains C57BL/6J mice Janvier Labs https://janvier-labs.com/en/fiche_produit/ 2_c57bl-6j_mouse/; RRID: IMSR_RJ: C57BL-6JRJ Pcp2-cre mice Erasmus University, bred inhouse N/A Software and algorithms Bpod State Machine r1 system Sanworks https://github.com/sanworks/Bpod; RRID: SCR_015943 Coreldraw Corel https://www.coreldraw.com/en/; RRID: SCR_013674 CaIMaN Giovannucci et al. 104 github.com/flatironinstitute/CaImAn- MATLAB ImageJ/FIJI NIH https://imagej.nih.gov/ij/; RRID: SCR_002285 Illustrator Abobe RRID: SCR_010279 Leica Application Suite (LAS) X (3.10.1.29575) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/leicalas-x-ls/; RRID: SCR_013673 MATLAB (R2022b, R2024b) MathWorks https://www.mathworks.com/; RRID: SCR_001622 MATLAB analysis code/information theory calculation Kitazawa et al. 10 ; this paper https://github.com/irinamarguerita/ ScheerPrsa_2025 NDP view2 software Hamamatsu, Nanozoomer https://nanozoomer.hamamatsu.com/jp/ en.html OASIS Friedrich et al. 105 github.com/zhoupc/OASIS_matlab (Continued on next page) Cell Reports 44, 116444, October 28, 2025 15 .. For climbing fiber imaging and behavioral experiments we used C57BL/6 mice (Janvier Labs; 2 males, 6 females, 8 to 12 weeks of age at the start of experiments).

    Software:

    Article Title: The olivocerebellar system differentially encodes the effect sensory events exert on behavior.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 594 Jackson ImmunoResearch Cat# 715-585-150; RRID: AB_2340854 Calbindin D-28k Swant Cat# 300; RRID: AB_10000347 Bacterial and virus strains AAV1-CamKII-GCaMP8m Zurich Viral Vector Facility 630–1 AAV1-hSyn-dlox-RCAMP1.07 Zurich Viral Vector Facility 273–1 Chemicals, peptides, and recombinant proteins Buprenorphine (Bupaq) Streuli Pharma Swissmedic ref. A 63081; ATCVet code: QN02AE01 Carprofen (Rymadil) Zoetis Swissmedic ref. 54 ′ 375 018 Dako fluorescence mounting medium Dako S3023 DAPI Sigma-Aldrich #MBD0015 Dexamethasone (Mephameson) Mepha A75537B Sodium Pentobarbital (Esconarkon) Streuli Pharma Swissmedic ref. 55815 Isoflurane Piramal Pharma Limited Swissmedic ref. 56 ′ 761 Lidocaine Streuli Pharma Swissmedic ref. 30 ′ 015 Normal Donkey Serum Jackson ImmunoResearch #017-000-121 Paraformaldehyde Roth 0964.2 Triton X-100 Sigma-Aldrich 92046-34-9 Tween 20 Sigma-Aldrich 9005-64-5 Vectashield antifade mounting medium with DAPI Vectashield H-1200 Experimental models: Organisms/strains C57BL/6J mice Janvier Labs https://janvier-labs.com/en/fiche_produit/ 2_c57bl-6j_mouse/; RRID: IMSR_RJ: C57BL-6JRJ Pcp2-cre mice Erasmus University, bred inhouse N/A Software and algorithms Bpod State Machine r1 system Sanworks https://github.com/sanworks/Bpod; RRID: SCR_015943 Coreldraw Corel https://www.coreldraw.com/en/; RRID: SCR_013674 CaIMaN Giovannucci et al. 104 github.com/flatironinstitute/CaImAn- MATLAB ImageJ/FIJI NIH https://imagej.nih.gov/ij/; RRID: SCR_002285 Illustrator Abobe RRID: SCR_010279 Leica Application Suite (LAS) X (3.10.1.29575) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/leicalas-x-ls/; RRID: SCR_013673 MATLAB (R2022b, R2024b) MathWorks https://www.mathworks.com/; RRID: SCR_001622 MATLAB analysis code/information theory calculation Kitazawa et al. 10 ; this paper https://github.com/irinamarguerita/ ScheerPrsa_2025 NDP view2 software Hamamatsu, Nanozoomer https://nanozoomer.hamamatsu.com/jp/ en.html OASIS Friedrich et al. 105 github.com/zhoupc/OASIS_matlab (Continued on next page) Cell Reports 44, 116444, October 28, 2025 15 .. For climbing fiber imaging and behavioral experiments we used C57BL/6 mice (Janvier Labs; 2 males, 6 females, 8 to 12 weeks of age at the start of experiments).



    Similar Products

    donkey serum jackson immunoresearch  (Jackson Immuno)
    96
    Jackson Immuno donkey serum jackson immunoresearch
    Donkey Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pm41932324-250-113-115
    Average 96 stars, based on 1 article reviews
    donkey serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    v v normal donkey serum jackson immunoresearch laboratories 017 000 121  (Jackson Immuno)
    96
    Jackson Immuno v v normal donkey serum jackson immunoresearch laboratories 017 000 121
    V V Normal Donkey Serum Jackson Immunoresearch Laboratories 017 000 121, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pm41819103-1065-21-25
    Average 96 stars, based on 1 article reviews
    v v normal donkey serum jackson immunoresearch laboratories 017 000 121 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    normal donkey serum jackson immunoresearch  (Jackson Immuno)
    96
    Jackson Immuno normal donkey serum jackson immunoresearch
    Normal Donkey Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pm41805292-75-80-83
    Average 96 stars, based on 1 article reviews
    normal donkey serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    v v normal donkey serum jackson immunoresearch laboratories suffolk uk  (Jackson Immuno)
    96
    Jackson Immuno v v normal donkey serum jackson immunoresearch laboratories suffolk uk
    V V Normal Donkey Serum Jackson Immunoresearch Laboratories Suffolk Uk, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pm41750253-48-12-16
    Average 96 stars, based on 1 article reviews
    v v normal donkey serum jackson immunoresearch laboratories suffolk uk - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    v v donkey serum 017 000 121 jackson immunoresearch  (Jackson Immuno)
    96
    Jackson Immuno v v donkey serum 017 000 121 jackson immunoresearch
    V V Donkey Serum 017 000 121 Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pm41763035-40-16-20
    Average 96 stars, based on 1 article reviews
    v v donkey serum 017 000 121 jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    v v normal donkey serum jackson immunoresearch laboratories bar harbor me  (Jackson Immuno)
    96
    Jackson Immuno v v normal donkey serum jackson immunoresearch laboratories bar harbor me
    V V Normal Donkey Serum Jackson Immunoresearch Laboratories Bar Harbor Me, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/donkey+serum+jackson+immunoresearch/Normal+Donkey+Serum/pmc12738881-159-18-22
    Average 96 stars, based on 1 article reviews
    v v normal donkey serum jackson immunoresearch laboratories bar harbor me - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results